text-processing

text-processing

text-processing – ¿Cómo seguir (a la "tail -f") un archivo binario desde el principio?

Pregunta: ¿Es posible seguir un archivo binario desde el principio, a la tail -f ? Esto es útil en algunos casos, por ejemplo, si estoy scp un archivo a un servidor remoto y, al mismo tiempo, quiero enviarlo a otro proceso (sí, sé que puedo usar trucos ssh + cat ). Por lo que leí …

text-processing – ¿Cómo seguir (a la "tail -f") un archivo binario desde el principio? Read More »

text-processing – ¿Cómo escribo un sed de una línea para agregar un carácter después de cada tercer carácter?

Pregunta: Entonces, tengo una cadena que se ve así: AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA Y quiero dividir la cadena en trozos de 3 caracteres delimitados por un signo '+'. AUG+GCC+AUG+GCG+CCC+AGA+ACU+GAG+AUC+AAU+AGU+ACC+CGU+AUU+AAC+GGG+UGA Y quiero hacer eso con mi buen amigo sed . Lo intenté cat codons | sed -r ‘s/([A-Z]\{3\})/\1\+/g’ … sin éxito. ¿Qué comando sed puedo usar? Respuesta: Como no …

text-processing – ¿Cómo escribo un sed de una línea para agregar un carácter después de cada tercer carácter? Read More »

text-processing – Convierta un archivo delimitado por tabulaciones para usar nuevas líneas

Pregunta: input.txt (alrededor de 30K líneas) RT|367079254|bn|ERTS01065811.1| 38 1 503 RT|367079251|bn|ERTS01065814.1| 56 3 502 RT|367079248|bn|ERTS01065817.1| 52 2 502 output.txt RT|367079254|bn|ERTS01065811.1| 38 1 503 RT|367079251|bn|ERTS01065814.1| 56 3 502 RT|367079248|bn|ERTS01065817.1| 52 2 502 Respuesta: Creo que tu forma más fácil de hacer esto es con tr : tr ‘\t’ ‘\n’ < input.txt > output.txt Eso convertirá todas …

text-processing – Convierta un archivo delimitado por tabulaciones para usar nuevas líneas Read More »

text-processing – ¿Cómo poner una búsqueda de cadena con el comando grep en la declaración if?

Pregunta: Quiero buscar varias cadenas en dos archivos. Si se encuentra una cadena en ambos archivos, haga algo. Si una cadena se encuentra en un solo archivo, entonces cree otra cosa. Mis comandos son los siguientes: ####This is for the affirmative sentence in both files if grep -qw “$users” “$file1” && grep -qw “$users” “$file2”; …

text-processing – ¿Cómo poner una búsqueda de cadena con el comando grep en la declaración if? Read More »

text-processing – Análisis de archivos de registro para direcciones IP frecuentes

Pregunta: Entonces, pirateé esto mientras me sometía a un ataque DDOS para sacar ips traviesos de mis registros. ¿Alguien tiene alguna mejora u otras sugerencias para mejorarlo? Esta es la idea general: Extraiga la única IP del archivo de registro ordenarlos uniq y contarlos ordenarlos de nuevo Y la cuerda de las tuberías: cut –delim …

text-processing – Análisis de archivos de registro para direcciones IP frecuentes Read More »

text-processing – Verifique que todas las líneas de un archivo sean únicas

Pregunta: Tengo un archivo de texto que contiene líneas como esta: This is a thread 139737522087680 This is a thread 139737513694976 This is a thread 139737505302272 This is a thread 139737312270080 . . . This is a thread 139737203164928 This is a thread 139737194772224 This is a thread 139737186379520 ¿Cómo puedo estar seguro de la …

text-processing – Verifique que todas las líneas de un archivo sean únicas Read More »

text-processing – Obtener el número de línea de la compensación de bytes

Pregunta: Tener desplazamiento de bytes para un archivo. ¿Existe una herramienta que proporcione un número de línea para este byte? El recuento de bytes comienza con cero, como en: el primer byte es 0, no 1. Número de línea que comienza con 1. El archivo puede tener texto plano, blobs "binarios", caracteres multibyte, etc. Pero …

text-processing – Obtener el número de línea de la compensación de bytes Read More »

text-processing – Imprimir líneas entre (y excluyendo) dos patrones

Pregunta: Voy a enviar el formulario usando cURL, donde algunos de los contenidos provienen de otro archivo, seleccionado usando sed Si param1 es un patrón de coincidencia de línea de otro archivo que usa sed , el siguiente comando funcionará bien: curl -d param1=”$(sed -n ‘/matchpattern/p’ file.txt)” -d param2=value2 http://example.com/submit Ahora, ve al problema. Quiero …

text-processing – Imprimir líneas entre (y excluyendo) dos patrones Read More »

text-processing – ¿Cómo 'cat' un archivo de texto pero empiezo desde abajo en lugar de desde arriba?

Pregunta: Tengo un archivo de registro de texto muy grande de aproximadamente 37 MB. Usando el cat file | more Puedo ver el contenido del archivo una página a la vez. El problema es que esto siempre comienza desde arriba: las entradas antiguas. ¿Cómo puedo hacer que comience desde la parte inferior donde las entradas …

text-processing – ¿Cómo 'cat' un archivo de texto pero empiezo desde abajo en lugar de desde arriba? Read More »

Scroll to Top

istanbul avukat

-

web tasarım